View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16658_high_21 (Length: 382)
Name: NF16658_high_21
Description: NF16658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16658_high_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 3e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 187 - 364
Target Start/End: Complemental strand, 7069538 - 7069365
Alignment:
| Q |
187 |
gattagagaaagtataagaccaaaaacatttataggaatttgaccgaacatgtttcaagttttaaaaacaaacatctaaatgataaatactaaatatatg |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | || |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7069538 |
gattagagaaagtataagaccaaaaacatttattgatatatgaccgaacatgtttcaagttttaaaaacaaacatctaaatgat-aatactaaatatatg |
7069440 |
T |
 |
| Q |
287 |
ttaattatggacagtggcctttctcatatttgctttacatccaaagaaatgttgtaattcaatttgatacattgttct |
364 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7069439 |
ttaattatggacagtggcctttctcatatttgctttacatccaaagaaa---tgtaattcaatttgatacattgttct |
7069365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University