View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16658_high_32 (Length: 282)
Name: NF16658_high_32
Description: NF16658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16658_high_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 22 - 264
Target Start/End: Original strand, 44998411 - 44998653
Alignment:
| Q |
22 |
aggcggtgggaagcggaggagggagtacttgggaggtagctgtggtggaggagaggagaaagaggcagcaaataaggaggagaaggatgaagatgaaggg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44998411 |
aggcggtgggaagcggaggagggagtacttgggaggtagctgtggtggaggagaggagaaagaggcagcaaataaggaggagaaggatgaagatgaaggg |
44998510 |
T |
 |
| Q |
122 |
aaatggtgatcatggtgagaatgaagaaggagacgaggaggaagaagataacatcagtggtggcggtgagagacaaagagaacatccattcattgtgaca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44998511 |
aaatggtgatcatggtgagaatgaagaaggagacgaggaggaagaagataacatcagtggtggcggtgagagacaaagagaacatccattcattgtgaca |
44998610 |
T |
 |
| Q |
222 |
gagcctggggaagttgcacgtggcaaaaagaacggtctagatt |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44998611 |
gagcctggggaagttgcacgtggcaaaaagaacggtctagatt |
44998653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University