View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16658_high_44 (Length: 236)
Name: NF16658_high_44
Description: NF16658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16658_high_44 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 48868076 - 48867852
Alignment:
| Q |
1 |
ttatacaattttttctgttgcttgttgataaatatttccttttgatgcagaaacaattatatgctaattactctggtgggaaatcaaagtgacagcaaga |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48868076 |
ttatacaattttctctgttgcttgttgataaatatttccttttgatgcagaaacaattatatgctaattactctggtgggaaatcaaagtgacagcaaga |
48867977 |
T |
 |
| Q |
101 |
ttggaagtatttaaatatgcatcaagtcatgcttgttgttgctgatgaattttatagaatgtgaaaaagtcttca---atatactctattttccaagttt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
48867976 |
ttggaagtatttaaatatgcatcaagtcatgcttgttgttgctgatgaattttatagaatgtgaaaaagtcttcaaatatatactctattttccaagttt |
48867877 |
T |
 |
| Q |
198 |
tgttttctcaaccagattaattatt |
222 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
48867876 |
tgttttctcaaccagattaattatt |
48867852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 40 - 87
Target Start/End: Original strand, 2906757 - 2906804
Alignment:
| Q |
40 |
ttttgatgcagaaacaattatatgctaattactctggtgggaaatcaa |
87 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||||||| ||||| |
|
|
| T |
2906757 |
ttttgatgcagaaacaattatatgccaatttctctggtgggacatcaa |
2906804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University