View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16658_high_45 (Length: 222)
Name: NF16658_high_45
Description: NF16658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16658_high_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 16 - 208
Target Start/End: Complemental strand, 15428712 - 15428520
Alignment:
| Q |
16 |
caaaaagatattttaacttataggaaatgtatgagtgcataactagtagaaacatannnnnnnnnnnnnnnnnncatctgttagagaggatagggtnnnn |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15428712 |
caaaaagatattttaacttataggaaatgtatgagtgcataactagtagaaacatagtgtgtgttttgtgtgtgcatctgttagagaggatagggtcccc |
15428613 |
T |
 |
| Q |
116 |
nnntctcttggtactcaacccaaaagttattaatgttcttgcagtatacttataaaacactccctaccctgtctgaaaaatgcatggtatatt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15428612 |
ccctctcttggtactcaacccaaaagttattaatgttcttgcagtatacttataaaacactccctaccctgtctgaaaaatgcatggtatatt |
15428520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University