View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16658_low_26 (Length: 369)
Name: NF16658_low_26
Description: NF16658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16658_low_26 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 18 - 369
Target Start/End: Complemental strand, 49945025 - 49944674
Alignment:
| Q |
18 |
ataatgaacacctctttcttcggaatcaagcttcattcttctttcaaagtttacaacactatcactatcaatagtaacaatcatttggagttgttggaga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49945025 |
ataatgaacacctctttcttcggaatcaagcttcattcttctttcaaagtttacaacactatcactatcaatagtaacaatcatttggagttgttggaga |
49944926 |
T |
 |
| Q |
118 |
gaagaagattattgcagaaaagcaaaaggtggtgcactgtatctgcgaaacatggacgcccaataaggcaagtttttagtttttgttgtcaaaatgtaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49944925 |
gaagaagattattgcagaaaagcaaaaggtggtgcactgtatctgcgaaacatggacgcccaataaggcaagtttttagtttttgttgtcaaaatgtaaa |
49944826 |
T |
 |
| Q |
218 |
cttgttgaggatacaccatgtttccgtaagtgggtctaggttgaaatgtactaataaagaatcacgcttttctcctttcttcactccattgtggaaagaa |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49944825 |
cttgttgaggatacaccatgtttccgtaagtgggtctaggttgaaatgtactaatgaagaatcacgcttttctcctttcttcactccattgtggaaagaa |
49944726 |
T |
 |
| Q |
318 |
gggannnnnnngatgagggtatgtgtttacactgttgttatctctggtttgt |
369 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49944725 |
gggatttttttgatgagggtatgtgtttacactgttgttatctctggtttgt |
49944674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University