View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16658_low_29 (Length: 340)
Name: NF16658_low_29
Description: NF16658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16658_low_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 33 - 325
Target Start/End: Original strand, 32113841 - 32114133
Alignment:
| Q |
33 |
gaaggaaggaaggaagaaaccgatgtgcagtctcgttcgttattttgtgttcgtctctttaacaagataatgacaaattagtgagaacgaaaccttagtc |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32113841 |
gaaggaaggaaggaagaaaccgatgtgcagtctcgttcgttattttgtgttcgtctctttaacaagataatgacaaattaatgagaacgaaaccttagtc |
32113940 |
T |
|
| Q |
133 |
aactcaacaaagtcacaaactaaaacaaaacaactttttcctccatcatgaatttcattttttgtgtgtgtttggaatatcatgatattcatttcatact |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32113941 |
aactcaacaaagtcacaaactaaaacaaaacaactttttcctccatcatgattttcattttttgtgtgtgtttggaatatcatgatattcatttcatact |
32114040 |
T |
|
| Q |
233 |
catcatagaagctttgccccatgatgatccccataaatgagtccgaccaaacaagaaattctaaacacaaaagtctctcaaaatatcaaagtg |
325 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32114041 |
catcattgaagctttgccccatgatgatccccataaatgagtccgaccaaacaagaaattctaaacacaaaagtctctcaaaatatcaaagtg |
32114133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University