View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16658_low_30 (Length: 331)
Name: NF16658_low_30
Description: NF16658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16658_low_30 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 1 - 178
Target Start/End: Complemental strand, 25422633 - 25422459
Alignment:
| Q |
1 |
gttcaatcaccatagctttgtggctactacaatgctcaccacgatacctatccagattaagggcaaaacgatatgcaatagaccttacaacatctgataa |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25422633 |
gttcaatcaccatagctttgtggctac---aatgctcaccaagatacctatccagattaagagcaaaacgatatgcaatagaccttacaacatctgataa |
25422537 |
T |
|
| Q |
101 |
ctatagtatactaaataaattagtcaatggtacactaatattccctttaataaatcattgtacacaatatatctctta |
178 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
25422536 |
ctatagtatactaaataaagtagtcaatggtacactaatattccctttgataaatcattgtacacaatatatctctta |
25422459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University