View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16658_low_37 (Length: 289)
Name: NF16658_low_37
Description: NF16658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16658_low_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 95; Significance: 2e-46; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 180 - 278
Target Start/End: Complemental strand, 33686287 - 33686189
Alignment:
| Q |
180 |
taagatgtatcattgttgaattaatcctgatgtgtaaatgtgttatttattggtgtattgttgtcttctaatttgcaggtacccaccatcatcatcatc |
278 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33686287 |
taagatgtatcattgttgaattaatccttatgtgtaaatgtgttatttattggtgtattgttgtcttctaatttgcaggtacccaccatcatcatcatc |
33686189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 128 - 182
Target Start/End: Complemental strand, 33686456 - 33686403
Alignment:
| Q |
128 |
ttaaaactattagatcaaaaaggaacaccaatcatattatagtctgtccacataa |
182 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33686456 |
ttaaaactattagat-aaaaaggaacaccaatcatattatagtctgcccacataa |
33686403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 136 - 180
Target Start/End: Complemental strand, 48381285 - 48381241
Alignment:
| Q |
136 |
attagatcaaaaaggaacaccaatcatattatagtctgtccacat |
180 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
48381285 |
attagatcaaagaggaacaccaatcatattatagtctgtccacat |
48381241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 185 - 259
Target Start/End: Complemental strand, 34588707 - 34588632
Alignment:
| Q |
185 |
tgtatcattgttgaattaatcctgatgtgtaaatgtgttatttattggtgtattg-ttgtcttctaatttgcaggt |
259 |
Q |
| |
|
||||| ||||||||||||||||| ||| ||||||| || ||||| |||||||||| || ||||| ||||||||||| |
|
|
| T |
34588707 |
tgtataattgttgaattaatccttatgcgtaaatgcgtgatttaatggtgtattgtttttcttccaatttgcaggt |
34588632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 109 - 173
Target Start/End: Original strand, 4310334 - 4310398
Alignment:
| Q |
109 |
ccatcataggaaagtttctttaaaactattagatcaaaaaggaacaccaatcatattatagtctg |
173 |
Q |
| |
|
||||||| ||||||||| |||||||| ||||||||||| |||||||| ||||| |||| ||||| |
|
|
| T |
4310334 |
ccatcatgggaaagtttttttaaaaccattagatcaaagaggaacacggatcattttatggtctg |
4310398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University