View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16658_low_39 (Length: 281)
Name: NF16658_low_39
Description: NF16658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16658_low_39 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 19 - 266
Target Start/End: Original strand, 39681186 - 39681433
Alignment:
| Q |
19 |
cctaggcaatcacaccatgtggcagctaaaaggatacctaaagggaaaactagattatgatgttctatatatttcctagcggcagaggaaaaaataatgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
39681186 |
cctaggcaatcacaccatgtggcagccaaaaggatatctaaagggaaaactagattatgatgttctatatatttcctagcggcagaggaaaaaataattt |
39681285 |
T |
 |
| Q |
119 |
ggagctactgtggggtatggcgataaatttgaaagtagaaacacaatggggtatatatgttttactaaattcgttggagcactaatctcttgaataatac |
218 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
39681286 |
ggagctactatgggatatggcgataaatttgaaagtagaaacacaatggggtatatatgttttactaaattcgttagagcaataatctcttgaataatac |
39681385 |
T |
 |
| Q |
219 |
attgtagtctcacatgttgaataccaagtcttatgtcttcaatctctg |
266 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39681386 |
attgcagtctcacatgttgaataccaagtcttatgtcttcaatctctg |
39681433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University