View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16658_low_42 (Length: 257)

Name: NF16658_low_42
Description: NF16658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16658_low_42
NF16658_low_42
[»] chr1 (2 HSPs)
chr1 (47-239)||(28375059-28375252)
chr1 (1-32)||(28375318-28375349)


Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 47 - 239
Target Start/End: Complemental strand, 28375252 - 28375059
Alignment:
47 tatttttagttttaaca-gttagaattggttttaaattgcttccaagttggtggtgcagggcagcttttgttgtgtttctctacggcttgttgttctagg 145  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28375252 tatttttagttttaacaagttagaattggttttaaattgcttccaagttggtggtgcagggcagcttttgttgtgtttctctacggcttgttgttctagg 28375153  T
146 tctcgtgacgacgctcatgttttcacttttacttagtttaatttatctcagagagcagtttggtgttgtcagttataatctagtacgatgaaat 239  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||    
28375152 tctcgtcacgacgctcatgttttcacttttacttagtttaatttatctcagagagcagtttggtgttgtcaattataatccagtacgatgaaat 28375059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 32
Target Start/End: Complemental strand, 28375349 - 28375318
Alignment:
1 cttcaaattggaggagaacttgagtcatgcat 32  Q
    ||||||||||||||||||||||||||||||||    
28375349 cttcaaattggaggagaacttgagtcatgcat 28375318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University