View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16658_low_42 (Length: 257)
Name: NF16658_low_42
Description: NF16658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16658_low_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 47 - 239
Target Start/End: Complemental strand, 28375252 - 28375059
Alignment:
| Q |
47 |
tatttttagttttaaca-gttagaattggttttaaattgcttccaagttggtggtgcagggcagcttttgttgtgtttctctacggcttgttgttctagg |
145 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28375252 |
tatttttagttttaacaagttagaattggttttaaattgcttccaagttggtggtgcagggcagcttttgttgtgtttctctacggcttgttgttctagg |
28375153 |
T |
 |
| Q |
146 |
tctcgtgacgacgctcatgttttcacttttacttagtttaatttatctcagagagcagtttggtgttgtcagttataatctagtacgatgaaat |
239 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
28375152 |
tctcgtcacgacgctcatgttttcacttttacttagtttaatttatctcagagagcagtttggtgttgtcaattataatccagtacgatgaaat |
28375059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 32
Target Start/End: Complemental strand, 28375349 - 28375318
Alignment:
| Q |
1 |
cttcaaattggaggagaacttgagtcatgcat |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
28375349 |
cttcaaattggaggagaacttgagtcatgcat |
28375318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University