View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16658_low_47 (Length: 241)
Name: NF16658_low_47
Description: NF16658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16658_low_47 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 20 - 227
Target Start/End: Complemental strand, 10463478 - 10463271
Alignment:
| Q |
20 |
gttgatacgactattgtgtcataacgcgatcctggggatcaattgttgaactaagagctactacacagatgttgaatcttaagacattagatacaaagat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10463478 |
gttgatacgactattgtgtcataacgcgatcctggggatcaattgttgaactaagagctactacacagatgttgaatcttaagacattagatacaaagat |
10463379 |
T |
|
| Q |
120 |
tttctcacttatacgctgttaaacataaactttttcatctaatgtgaaacgtctaacgcacacttgacacaccaataactttgctttcaaacagaaaaat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10463378 |
tttctcacttatacgctgttaaacataaactttttcatctaatgtgaaacgtctaacgcacacttgacacaccaataactttgctttcaaacagaaaaat |
10463279 |
T |
|
| Q |
220 |
agaataat |
227 |
Q |
| |
|
|||||||| |
|
|
| T |
10463278 |
agaataat |
10463271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University