View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16658_low_52 (Length: 215)

Name: NF16658_low_52
Description: NF16658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16658_low_52
NF16658_low_52
[»] chr1 (1 HSPs)
chr1 (132-212)||(23470681-23470761)


Alignment Details
Target: chr1 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 132 - 212
Target Start/End: Complemental strand, 23470761 - 23470681
Alignment:
132 taagttcttttaactatattttgtccaaagtttggatatccatccttggccgatcgcatgcaaaaatatttgtaggaagag 212  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
23470761 taagttcttttaactatattttgtcgaaagtttggatatccatccttggccggtcgcatgcaaaaatatttgtaggaagag 23470681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University