View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16659_high_14 (Length: 274)
Name: NF16659_high_14
Description: NF16659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16659_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 6e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 15 - 217
Target Start/End: Complemental strand, 26539187 - 26538982
Alignment:
| Q |
15 |
acttcactctgccgtaaattttaaatttccttttca-ttttattgattgaatactct--gtcattctctaactctaattgcaacaagaaaattgttcttt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| | |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26539187 |
acttcactctgccgtaaattttaaattttgatttaaattttattgattgaatactctctgtcattctctaactctaattgcaacaagaaaattgttcttt |
26539088 |
T |
 |
| Q |
112 |
tactttagtaatcaaattcactggataatcccatctttgtatttactgcaaagagaccctctcagctgttttttattataaaatagtttagatgagttgg |
211 |
Q |
| |
|
||| ||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
26539087 |
taccttaataatcaaattcattggataatcccatctttgtatttactgcaaagagaccctctcagccattttttattataaaatagtttagatgagttgg |
26538988 |
T |
 |
| Q |
212 |
tctaaa |
217 |
Q |
| |
|
|||||| |
|
|
| T |
26538987 |
tctaaa |
26538982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University