View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16660_high_2 (Length: 388)
Name: NF16660_high_2
Description: NF16660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16660_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 189 - 376
Target Start/End: Original strand, 14402338 - 14402525
Alignment:
| Q |
189 |
tgtctaaaattcatgattttatgccaagagttcagaattataaaacctcacagagctcttgagtaaaaataaagaatttgttggtgtgagaagcaaatgc |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
14402338 |
tgtctaaaattcatgattttatgccaagagttcagaattataaaacctcacagagttcttgagtaaaaataaagaatttgttggtgttagaagcaaatgc |
14402437 |
T |
|
| Q |
289 |
tggagcataaggtttacatggatatgcagagtatattggaggagtattttgtttggcagtgattgttcagttttggtcatgatttgat |
376 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14402438 |
tggagcatatggtttacatggatatgcagagtatattggaggagtattttctttggcagtgattgttcagttttggtcatgatttgat |
14402525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University