View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16660_low_8 (Length: 268)
Name: NF16660_low_8
Description: NF16660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16660_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 19 - 258
Target Start/End: Original strand, 39093237 - 39093485
Alignment:
| Q |
19 |
ggtgtattctttttctcttggttaataattaataatacacccatggttcccgtgtgaatactataataattagcctatgcacgtcattatcttaaaaaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39093237 |
ggtgtattctttttctcttggttaataattaataatacacccatggttcccgtgtgaatactataataattagcctatgcacgtcattatcttaaaaaat |
39093336 |
T |
 |
| Q |
119 |
attgccattatgataaac---------cgtgtataaaaatgttgagaaaattactcttatgtcattaaccaaattttaattttcgtgtctcaacaatttt |
209 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39093337 |
attgccattatgataaaccgtgtatctcgtgtataaaaatgttgagaaaattactcttatgtcattaaccaaattttaattttcgtgtctcaacaatttt |
39093436 |
T |
 |
| Q |
210 |
gagattcaattatgtatatattgtattagagatgccgaaggggcctttg |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
39093437 |
gagattcaattatgtatatattgtattagagatgcccaaggggcctttg |
39093485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University