View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16661_high_15 (Length: 439)
Name: NF16661_high_15
Description: NF16661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16661_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 7e-59; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 7e-59
Query Start/End: Original strand, 18 - 157
Target Start/End: Original strand, 33094042 - 33094181
Alignment:
| Q |
18 |
aattggacgatctaggaggagaatttcacgattcagacggtgaacttggtgatgctagaggcaaagtgggcgattcaggaggtgagcttggtgattcttg |
117 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33094042 |
aattggacgatctaggatgagaatttcgcgattcagacggtgaacttggtgatgctggaggcaaagtgggtgattcaggaggtgagcttggtgattcttg |
33094141 |
T |
 |
| Q |
118 |
aggtggactagacattttagaatttgaaggtgtacttggt |
157 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
33094142 |
aggtggactagacattttaggatttggaggtgtacttggt |
33094181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 262 - 353
Target Start/End: Original strand, 33100646 - 33100737
Alignment:
| Q |
262 |
tcgccacctctttgttaaaggtgaatgagattttgcaatgaaggactcaaatttctcaaaagaccattttatgtctcaaaagaaattacgct |
353 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33100646 |
tcgccacctatttgttaaaggtgaatgagattttggaatgaaggactcaaatttctcaaaagaccattttatgtctcaaaagaaattacgct |
33100737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 158 - 234
Target Start/End: Original strand, 33094235 - 33094311
Alignment:
| Q |
158 |
ccatccaggaataattggaatatcgggccatccatgtctgtctcgacaaggatgaattaattacaaatttttaaagc |
234 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33094235 |
ccatccaggtatgattggaatatcgggccatccatgtatgtcttgacaaggatgaattaattacaaatttttaaagc |
33094311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 393 - 430
Target Start/End: Original strand, 33100777 - 33100814
Alignment:
| Q |
393 |
aataacaatagcaatgaaggtgtgtctcttagtattat |
430 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33100777 |
aataacaatagcaatgaaggtgtgtctcttagtattat |
33100814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 158 - 191
Target Start/End: Original strand, 33094208 - 33094241
Alignment:
| Q |
158 |
ccatccaggaataattggaatatcgggccatcca |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
33094208 |
ccatccaggaataattggaatatcgggccatcca |
33094241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University