View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16661_high_18 (Length: 415)
Name: NF16661_high_18
Description: NF16661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16661_high_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 373; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 373; E-Value: 0
Query Start/End: Original strand, 18 - 409
Target Start/End: Original strand, 40031598 - 40031990
Alignment:
| Q |
18 |
ctttgctattatatagcatggaaactttttgcttcacgggttcgttttttctggttttccttgcagtaggttttgcaggaatttggtgttggggacaatt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40031598 |
ctttgctattatatagcatggaaactttttgcttcacgggttcattttttctggttttccttgcagtaggttttgcaggaatttggtgttggggacaatt |
40031697 |
T |
 |
| Q |
118 |
ttttatgtcttttttagcaggttgaagcaggggtgtggggcttattttcttgctttgtttctagggaagattagcttttatgttagaggttccttttgtt |
217 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40031698 |
tttgatgtcttttttagcaggttgaagcaggggtgtggggcttattttcttgctttgtttctagggaagattagcttttatgttagaggttccttttgtt |
40031797 |
T |
 |
| Q |
218 |
gttttgttactggttttatggtttagcttctattaccctgctagtgcaagtgtattagttagccaatcttcggttattcctt-tttctcatgtttattaa |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40031798 |
gttttgttactggttttatggtttagcttctattaccctgctagtgcaagtgtattagttagccaatcttcggttattccttgtttctcatgtttattaa |
40031897 |
T |
 |
| Q |
317 |
tgaaatgaaataaccttggctctttgatcacatgcataaaatcttccttataaatgaagattaaaatatgagatcattcgcaattcttctcac |
409 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40031898 |
tgaaatgaaataaccttggctctttgatcacatgcataaaatcttccttataaatgaagattaaaatatgagatcattcgcaattcttatcac |
40031990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University