View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16661_high_57 (Length: 227)
Name: NF16661_high_57
Description: NF16661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16661_high_57 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 140 - 175
Target Start/End: Original strand, 40960737 - 40960772
Alignment:
| Q |
140 |
aattatgaacattgcgcatcggcttttgtctaccgc |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
40960737 |
aattatgaacattgcgcatcggcttttgtctaccgc |
40960772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 101 - 131
Target Start/End: Original strand, 40960691 - 40960721
Alignment:
| Q |
101 |
aaatgaagttgattgaggtcaatttatatag |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
40960691 |
aaatgaagttgattgaggtcaatttatatag |
40960721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 57 - 86
Target Start/End: Complemental strand, 37972436 - 37972407
Alignment:
| Q |
57 |
cctaaccgctagaccatgggaccgattgtt |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37972436 |
cctaaccgctagaccatgggaccgattgtt |
37972407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University