View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16661_low_16 (Length: 439)

Name: NF16661_low_16
Description: NF16661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16661_low_16
NF16661_low_16
[»] chr5 (5 HSPs)
chr5 (18-157)||(33094042-33094181)
chr5 (262-353)||(33100646-33100737)
chr5 (158-234)||(33094235-33094311)
chr5 (393-430)||(33100777-33100814)
chr5 (158-191)||(33094208-33094241)


Alignment Details
Target: chr5 (Bit Score: 116; Significance: 7e-59; HSPs: 5)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 116; E-Value: 7e-59
Query Start/End: Original strand, 18 - 157
Target Start/End: Original strand, 33094042 - 33094181
Alignment:
18 aattggacgatctaggaggagaatttcacgattcagacggtgaacttggtgatgctagaggcaaagtgggcgattcaggaggtgagcttggtgattcttg 117  Q
    ||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||    
33094042 aattggacgatctaggatgagaatttcgcgattcagacggtgaacttggtgatgctggaggcaaagtgggtgattcaggaggtgagcttggtgattcttg 33094141  T
118 aggtggactagacattttagaatttgaaggtgtacttggt 157  Q
    |||||||||||||||||||| ||||| |||||||||||||    
33094142 aggtggactagacattttaggatttggaggtgtacttggt 33094181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 262 - 353
Target Start/End: Original strand, 33100646 - 33100737
Alignment:
262 tcgccacctctttgttaaaggtgaatgagattttgcaatgaaggactcaaatttctcaaaagaccattttatgtctcaaaagaaattacgct 353  Q
    ||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33100646 tcgccacctatttgttaaaggtgaatgagattttggaatgaaggactcaaatttctcaaaagaccattttatgtctcaaaagaaattacgct 33100737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 158 - 234
Target Start/End: Original strand, 33094235 - 33094311
Alignment:
158 ccatccaggaataattggaatatcgggccatccatgtctgtctcgacaaggatgaattaattacaaatttttaaagc 234  Q
    ||||||||| || |||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||    
33094235 ccatccaggtatgattggaatatcgggccatccatgtatgtcttgacaaggatgaattaattacaaatttttaaagc 33094311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 393 - 430
Target Start/End: Original strand, 33100777 - 33100814
Alignment:
393 aataacaatagcaatgaaggtgtgtctcttagtattat 430  Q
    ||||||||||||||||||||||||||||||||||||||    
33100777 aataacaatagcaatgaaggtgtgtctcttagtattat 33100814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 158 - 191
Target Start/End: Original strand, 33094208 - 33094241
Alignment:
158 ccatccaggaataattggaatatcgggccatcca 191  Q
    ||||||||||||||||||||||||||||||||||    
33094208 ccatccaggaataattggaatatcgggccatcca 33094241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University