View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16661_low_20 (Length: 368)
Name: NF16661_low_20
Description: NF16661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16661_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 19 - 365
Target Start/End: Original strand, 40376907 - 40377253
Alignment:
| Q |
19 |
tgatcgtcaacgtggaaatggtttgcttggttcaattcaattgacacatggtttgcttggttcgattcaattgacactcagtaagaatacaaaagtactt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40376907 |
tgatcgtcaacgtggaaatggtttgcttggttcaattcaattgacacatggtttgcttggttcgattcaattgacactcagtaagaatacaaaagtactt |
40377006 |
T |
 |
| Q |
119 |
aatgctgatactgatgagggaactcgacggatttcggatcacagtttagctaaggttttactggattctacagaaaatgttagacatcagagttgctcaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40377007 |
aatgctgatactgatgagggaactcgacggatttcggatcacagtttagctaaggttttactggattctacagaaaatgttagacatcagagttgctcaa |
40377106 |
T |
 |
| Q |
219 |
tttgtggctcattgaaagacacttcttgccatcaatctgcagaagagccttcagaaggatatgaagtatcatctggtgatggtggcaatgagaattctga |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
40377107 |
tttgtggctcattgaaagacacttcttgccatcaatctgcagaagagccttcagaaggatctgaagtctcatctggtgatggtggaaatgagaattcttt |
40377206 |
T |
 |
| Q |
319 |
ggcaatagtccctgtacagacaactgatgcggggaagctttaattga |
365 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||| |||||| |
|
|
| T |
40377207 |
ggcaatagtccctgtacagacaactgatgcagggcagcttgaattga |
40377253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University