View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16661_low_29 (Length: 315)
Name: NF16661_low_29
Description: NF16661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16661_low_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 10 - 308
Target Start/End: Complemental strand, 40377581 - 40377283
Alignment:
| Q |
10 |
aacaatatgcaagttgatgagtatttctcatgaaggccctccaattcttttggaatactttttaaattgcattcaggcgatgaataagttttccccattt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40377581 |
aacaatatgcaagttgatgagtatttctcatgaaggccctccaattcttttggaatactttttaaattgcattcaggcgacgaataagttttccccattt |
40377482 |
T |
|
| Q |
110 |
ccgaatctactggaataagggcaccactttcactatctaaagccacagattgaccctgagctttatcacaaatactaacttgtttatcatgatcaacatg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40377481 |
ccgaatctactggaataagggcaccactttcactatctaaagccacagattgaccctgagctttatcacaaatactaacttgtttatcatgatcaacatg |
40377382 |
T |
|
| Q |
210 |
gtatgaaagatttctacgcggcaacctcattgcccactgaaccacagagatctggtcccgcgtgaacagtatatcaggcaattgccggtctggtaaaaa |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
40377381 |
gtatgaaagatttctacgcggcaacctcattgcccactgaaccacagagatctggtcccgcgtgaacagtttatcaggtaattgccggtctggtaaaaa |
40377283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 10 - 64
Target Start/End: Complemental strand, 10258936 - 10258882
Alignment:
| Q |
10 |
aacaatatgcaagttgatgagtatttctcatgaaggccctccaattcttttggaa |
64 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
10258936 |
aacaatctgcaagtagatgagtatttctcatgaaggccctctaattctttaggaa |
10258882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University