View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16661_low_56 (Length: 237)
Name: NF16661_low_56
Description: NF16661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16661_low_56 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 10 - 220
Target Start/End: Original strand, 25252664 - 25252874
Alignment:
| Q |
10 |
acctgtgatatatatttgaaaataatttctgttaactttaacaatgtcatttgttgtcaatgttgaagcttgatgaataaatcaagtagaaatatggtta |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25252664 |
acctgtgatatatatttgaaaataatttctgttaactttaacaatgtcatctgttgtcaatattgaagcttgatgaataaatcaagtagaaatatggtta |
25252763 |
T |
 |
| Q |
110 |
aaatgtttaatatcagcgagcattcccacatgtagaaatcaacaacatcaaatgttgacaagtaaataaatgtcattatttctagtttatagcaatagat |
209 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25252764 |
aaatgtttaatatcagctagcattcccacatgtagaaatcaacaacatcaaatgttgacaagtaaataaatgtcatgatttctagtttatagcaatagat |
25252863 |
T |
 |
| Q |
210 |
tatgctattat |
220 |
Q |
| |
|
||||||||||| |
|
|
| T |
25252864 |
tatgctattat |
25252874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University