View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16661_low_57 (Length: 235)
Name: NF16661_low_57
Description: NF16661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16661_low_57 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 50 - 223
Target Start/End: Complemental strand, 38361055 - 38360882
Alignment:
| Q |
50 |
aaatgtgaatagttaagttccatatcaaataaaaatatttgatatataaatctaaaaatgtggtgtcaaaatctctgaataattctaaacgtttaatcca |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38361055 |
aaatgtgaatagttaagttccatatcaaatagaaatatttgatatataaatctaaaaatgtgatgtcaaaatctctcaataattctaaacgtttaatcca |
38360956 |
T |
 |
| Q |
150 |
tggacgttttcaactctatgttatcaaaaccataagtaaaaattgtggtgtcaaagtatttagtggtctaaatg |
223 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38360955 |
ttgacgttttcaactctatgttatcaaaaccataactaaaaattgtggtgtcaaagtatttagtggtctaaatg |
38360882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University