View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16661_low_60 (Length: 231)

Name: NF16661_low_60
Description: NF16661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16661_low_60
NF16661_low_60
[»] chr8 (1 HSPs)
chr8 (13-102)||(37234956-37235045)


Alignment Details
Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 13 - 102
Target Start/End: Original strand, 37234956 - 37235045
Alignment:
13 tagttatccatcactaaattatgtataacgatatatacctaaaaagagggaaacattaaggaaaagtacattaaagccctagatctaata 102  Q
    ||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
37234956 tagttatccatcactaaattatgtataactatatgtacctaaaaagagggaaacattaaggaaaagtacattaaagcactagatctaata 37235045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University