View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16662_high_30 (Length: 275)
Name: NF16662_high_30
Description: NF16662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16662_high_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 114; Significance: 7e-58; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 14 - 147
Target Start/End: Complemental strand, 30249610 - 30249477
Alignment:
| Q |
14 |
atgcacatcaccattttcgatcgtgtcatttccctcattcattcgaatagctactggtttaggaatcgtttcaaaaaataatccggttgaaaagcagtta |
113 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30249610 |
atgcacatctccattttagatcgtgtcatttccctcattaattcgaatagctactggtttaggaatcgtttcaaaaaataatccggttgaaaaccagtta |
30249511 |
T |
|
| Q |
114 |
aattgaactaaacaaattcgaaactataaattgg |
147 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
30249510 |
aattgaactaaacaaattagaaactataaattgg |
30249477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 215 - 260
Target Start/End: Complemental strand, 30249409 - 30249364
Alignment:
| Q |
215 |
agtaaaccattaatgtattaatgtggtccaattcaattgagtttat |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30249409 |
agtaaaccattaatgtattaatgtggtccaattcaattgagtttat |
30249364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University