View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16662_high_35 (Length: 238)
Name: NF16662_high_35
Description: NF16662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16662_high_35 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 8 - 238
Target Start/End: Original strand, 6968582 - 6968812
Alignment:
| Q |
8 |
cgcagaaaataatcatgcatatttattaaaatagaacattttggggtgccaaggttagaatctatatagcgtgaaaccttcaagttcaaggtgtgttcgg |
107 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| | |
|
|
| T |
6968582 |
cgcagaaaataatcatgaatatttattaaaatagaacattttggggtgccaaggttagaatctatataacgcgaaaccttcaagttcaaggtgtgttctg |
6968681 |
T |
 |
| Q |
108 |
tgtttgacaccaacacaatagctagttatgtttttcttaaattattaccgatgtctatgtgtcagtgacaatatgatgtcaggtatccatgtttgtgccg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6968682 |
tgtttgacaccaacacaatagctagttatgtttttcttaaattattaccgatgtctatgtgtcagtgacaatatcatgtcaggtatccatgtttgtgccg |
6968781 |
T |
 |
| Q |
208 |
gtagttcatacttgttagttgagtggatgaa |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
6968782 |
gtagttcatacttgttagttgagtggatgaa |
6968812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University