View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16662_high_38 (Length: 227)
Name: NF16662_high_38
Description: NF16662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16662_high_38 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 43910840 - 43910623
Alignment:
| Q |
1 |
tttttatactggatctggagattgaacccacgacttcttatgacaccgctagcataaagaaca----ataagaggacaagaaagtatttcatattccata |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||||||||||||||||| |
|
|
| T |
43910840 |
tttttatactggatctggagattgaacccacgacttcttatgacaccgctagcataaagaacatacaataag-ggacaggaaagtatttcatattccata |
43910742 |
T |
 |
| Q |
97 |
gtaccttgtgtttgtaacctgaattatgttgctttcttacagatggctgcaagaaacagaaacaaagaaaacaaagtaaaattatgtaattgtgaccaac |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43910741 |
gtaccttgtgtttgtaacctgaattatgttgctttcttacagatggctgcaaga------aacaaagaaaacaaagtaaaattatgtaattgtgaccaac |
43910648 |
T |
 |
| Q |
197 |
aaccttttcatggaattaaaacaaa |
221 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
43910647 |
aaccttttcatggaattaaaacaaa |
43910623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 99 - 148
Target Start/End: Original strand, 39976003 - 39976052
Alignment:
| Q |
99 |
accttgtgtttgtaacctgaattatgttgctttcttacagatggctgcaa |
148 |
Q |
| |
|
||||||||||| ||||| || ||||| |||||||| |||||||||||||| |
|
|
| T |
39976003 |
accttgtgtttataaccagagttatgctgctttctaacagatggctgcaa |
39976052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University