View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16662_low_42 (Length: 249)
Name: NF16662_low_42
Description: NF16662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16662_low_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 41604180 - 41604422
Alignment:
| Q |
1 |
attcaggagtaccaaacttcaccgggcattcggttatgttatttatatgaacatgtgaaagcaacattaaacctttaaatacacgtttgccaaaggtaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41604180 |
attcaggagtaccaaacttcaccgggcattcggttatgttatttatatgaacatgtgaaagcaacattaaacctttaaatacacgtttgccaaaggtaag |
41604279 |
T |
 |
| Q |
101 |
tagaaacatatgagttggaattgaattgacaagtttatccctactgaccaataccatacaactcacaacttaat-aataatatttagtttgcagaaaaac |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41604280 |
tagaaacatatgagttggaattgaattgacaagcttatccctactgaccaataccatacaactcacaacttaataaataatatttagtttgcagaaaaac |
41604379 |
T |
 |
| Q |
200 |
tcaaagcaaatcaagnnnnnnnttaaaatactggtttcttctc |
242 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41604380 |
tcaaagcaaatcaagaaagaaattaaaatactggtttcttctc |
41604422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University