View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16662_low_43 (Length: 246)
Name: NF16662_low_43
Description: NF16662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16662_low_43 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 15 - 240
Target Start/End: Original strand, 3427808 - 3428033
Alignment:
| Q |
15 |
atatataaccctaaatcttgtcaagtttatattggataaagcatattcaaatgctttaatagggtaacaacaaacacttacacaattgaccaacaaaaat |
114 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3427808 |
atatataaccctaaatcttgtcaagtctatattggataaagcatatacaaatgctttaatagggtaacaacaaacacttacacaattgaccaacaaaaat |
3427907 |
T |
 |
| Q |
115 |
ttcatcattcgatccaatattatagttcgcaattgcatatgaattagattacttatgtctttggttatttaattaacttctattgtaatttataataact |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3427908 |
ttcatcattcgatccaatattatagttcgcaattgcatatgaattagattacttatgtctttggttatttaattaacttctattgtaatttataataact |
3428007 |
T |
 |
| Q |
215 |
aaagaaatgtttgattcttctctctg |
240 |
Q |
| |
|
||||||||||||||||||||| |||| |
|
|
| T |
3428008 |
aaagaaatgtttgattcttctttctg |
3428033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University