View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16662_low_46 (Length: 237)
Name: NF16662_low_46
Description: NF16662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16662_low_46 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 6968470 - 6968219
Alignment:
| Q |
1 |
tgtgcatggttgcaacgtcgttgctggtgaacataatctatgtagttcagatcaaaggtgtgtccaatgtc---------------tgacacgactctga |
85 |
Q |
| |
|
||||||||||| || ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6968470 |
tgtgcatggttataaagtcattgctggtgaacataatctatgtagttcagatcaaaggtgtgtccaatgtcaaacgtgtcaatgtctgacacgactctga |
6968371 |
T |
 |
| Q |
86 |
ttttattactttctaaaattattatcactaactttgtgttagtatcaatgtcgtgtccgtatatgtgtcattgattcatagagttgtgttacttttcctt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6968370 |
ttttattactttctaaaattattatcactcactttgtgttagtatcaatgtcgtgtccgtatatgtgtcattgattcatagagttgtgttacttttcctt |
6968271 |
T |
 |
| Q |
186 |
gctgacaccttgtaacatcagggaaatatctttattatctcattgaatgttc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6968270 |
gctgacaccttgtaacatcagggaaatatctttattatctcattgaatgttc |
6968219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University