View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16662_low_52 (Length: 216)
Name: NF16662_low_52
Description: NF16662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16662_low_52 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 44491090 - 44490898
Alignment:
| Q |
1 |
tgaatgcttttacatttattttgagattggagaataatctctaacactcaagtcctttatttaggaaaagtgaagtttatactaatatagcaagctagcc |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
44491090 |
tgaatgcttttacatttattttgaaattggagaataatctctaacactcaagtcctttatttaggaaaagtgaagtttctactaatatagca----agcc |
44490995 |
T |
|
| Q |
101 |
tttactactgagtttcagagtgaatgtgacagggcaagatccgtgcatagttgtgacctgttaccaatggagcagcgcatatgcaacgagattgggta |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
44490994 |
tttactactgagtttcagagtgaatgtgacagggcaagatccgtgcatagttgtgacctgttaccaatggagcagcgca-atgcaacgagattgggta |
44490898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University