View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16663_low_11 (Length: 252)
Name: NF16663_low_11
Description: NF16663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16663_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 72; Significance: 7e-33; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 68 - 139
Target Start/End: Original strand, 4608244 - 4608315
Alignment:
| Q |
68 |
ctctaattcttgtctcttcaatatgaaggtgttttagattttgaagttttatgcaagtaatattctaatggg |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4608244 |
ctctaattcttgtctcttcaatatgaaggtgttttagattttgaagttttatgcaagtaatattctaatggg |
4608315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 203 - 238
Target Start/End: Original strand, 4608379 - 4608414
Alignment:
| Q |
203 |
gagcctctctctgataactttctgtgacatcttttt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
4608379 |
gagcctctctctgataactttctgtgacatcttttt |
4608414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 68 - 112
Target Start/End: Original strand, 4608159 - 4608203
Alignment:
| Q |
68 |
ctctaattcttgtctcttcaatatgaaggtgttttagattttgaa |
112 |
Q |
| |
|
|||||||||||||||||| | ||| ||||||||||||||||||| |
|
|
| T |
4608159 |
ctctaattcttgtctctttaccatgtaggtgttttagattttgaa |
4608203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University