View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16663_low_11 (Length: 252)

Name: NF16663_low_11
Description: NF16663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16663_low_11
NF16663_low_11
[»] chr8 (3 HSPs)
chr8 (68-139)||(4608244-4608315)
chr8 (203-238)||(4608379-4608414)
chr8 (68-112)||(4608159-4608203)


Alignment Details
Target: chr8 (Bit Score: 72; Significance: 7e-33; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 68 - 139
Target Start/End: Original strand, 4608244 - 4608315
Alignment:
68 ctctaattcttgtctcttcaatatgaaggtgttttagattttgaagttttatgcaagtaatattctaatggg 139  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4608244 ctctaattcttgtctcttcaatatgaaggtgttttagattttgaagttttatgcaagtaatattctaatggg 4608315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 203 - 238
Target Start/End: Original strand, 4608379 - 4608414
Alignment:
203 gagcctctctctgataactttctgtgacatcttttt 238  Q
    ||||||||||||||||||||||||||||||||||||    
4608379 gagcctctctctgataactttctgtgacatcttttt 4608414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 68 - 112
Target Start/End: Original strand, 4608159 - 4608203
Alignment:
68 ctctaattcttgtctcttcaatatgaaggtgttttagattttgaa 112  Q
    |||||||||||||||||| |  ||| |||||||||||||||||||    
4608159 ctctaattcttgtctctttaccatgtaggtgttttagattttgaa 4608203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University