View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16664_low_11 (Length: 205)
Name: NF16664_low_11
Description: NF16664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16664_low_11 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 65 - 205
Target Start/End: Complemental strand, 43555078 - 43554938
Alignment:
| Q |
65 |
tttgataaattactaaccatctnnnnnnntttatcagatgaattggaactaatttttaaatttttattgttagatgaattgaatagatttaacttttgat |
164 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
43555078 |
tttgataaattactaaccatctaaaaaaattaatcagatgaattggaactaatttttaaattattattgttagatgaattgaatagatttaactttagat |
43554979 |
T |
 |
| Q |
165 |
gaattgcatatatgtgaagagatgaatatatttaccaccct |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43554978 |
gaattgcatatatgtgaagagatgaatatatttaccaccct |
43554938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University