View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16665_high_14 (Length: 257)
Name: NF16665_high_14
Description: NF16665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16665_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 8184572 - 8184461
Alignment:
| Q |
1 |
tgtgtagagagctggtaaatcttagtcttacctgatatgaagaagagatttggcagcattaatgttagacatggtgaagaaaaccattgtaaaaagtaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8184572 |
tgtgtagagagctggtaaatcttagtcttacctgatatgaagaagagatttggcagcattaatgttagacatggtgaagaaaaccattgtaaaaagtaca |
8184473 |
T |
 |
| Q |
101 |
aaacaaagagtg |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
8184472 |
aaacaaagagtg |
8184461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 158 - 240
Target Start/End: Complemental strand, 8184360 - 8184284
Alignment:
| Q |
158 |
cccagattatggcatatctcaagttttattgagtatttaatttggccatggccacggccacaaaatgctttatgtgaggattc |
240 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
8184360 |
cccagattatggcatatctcaaattttattgagtatttaatttg------gccacggccacaatatgctttatgtgaggattc |
8184284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University