View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16666_high_13 (Length: 342)
Name: NF16666_high_13
Description: NF16666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16666_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 110 - 332
Target Start/End: Complemental strand, 43900246 - 43900024
Alignment:
| Q |
110 |
tgcaatttggtgttaagaaaatgaatacagtattatcctttttctgtttggattttaagatcttcagttgattgatatgaaaagctaaaactaagcttag |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43900246 |
tgcaatttggtgttaagaaaatgaatacagtattatcctttttctgtttggattttaagatcttcagttgattgatatgaaaagctaaaactaagcttag |
43900147 |
T |
 |
| Q |
210 |
actctcaacctttgccaatgtaaaaatgtatgagattttgaaaaatgtgattattattaggcgactagtgataattagttatcaattcttctcgaaattt |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43900146 |
actctcaacctttgccaatgtaaaaatgtatgagattttgaaaaatgtgattattattaggcgactagtgataattagttatcaattcttctcgaaattt |
43900047 |
T |
 |
| Q |
310 |
gactggaattatgatttaatatt |
332 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
43900046 |
gactggaattatgatttaatatt |
43900024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 43900395 - 43900351
Alignment:
| Q |
1 |
aaaatgcatagattcactaatgaaaaatgccgtccgtggggtatc |
45 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43900395 |
aaaatacatagattcactaatgaaaaatgccgtccgtggggtatc |
43900351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University