View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16666_high_17 (Length: 295)
Name: NF16666_high_17
Description: NF16666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16666_high_17 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 96; Significance: 4e-47; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 192 - 295
Target Start/End: Original strand, 30347557 - 30347660
Alignment:
| Q |
192 |
tttcaaagttcacattgtttagaaagaaatgtgtccataaacctattgtagataagattatgttcaagagcagtaacaaaagtaagagtgatcttgatac |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
30347557 |
tttcaaagttcacattgtttagaaagaaatgtgtccataaacctattgtagataagattatgttcaagagcaataacaagagtaagagtgatcttgatac |
30347656 |
T |
|
| Q |
292 |
tctt |
295 |
Q |
| |
|
|||| |
|
|
| T |
30347657 |
tctt |
30347660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 23 - 77
Target Start/End: Original strand, 24750499 - 24750553
Alignment:
| Q |
23 |
ctcttcacttggccccttgatgggtactttttctatacttccctcttttctcata |
77 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||| ||| |||||||| | |||||| |
|
|
| T |
24750499 |
ctcttcacttggcccctcgatggatactttttccatatttccctctatgctcata |
24750553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University