View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16666_high_7 (Length: 403)
Name: NF16666_high_7
Description: NF16666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16666_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 366; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 366; E-Value: 0
Query Start/End: Original strand, 14 - 387
Target Start/End: Complemental strand, 47003127 - 47002754
Alignment:
| Q |
14 |
agggataaagttgttaggaagagaccagtgctcattgttttcattccttttggtgattgtgttatgaagaaatcaagttgtcctgtgtatatgaatgctt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47003127 |
agggataaagttgttaggaagagaccagtgctcattgttttcattccttttggtgattgtgttatgaagaaatcaagttgtcctgtgtatatgaatgctt |
47003028 |
T |
|
| Q |
114 |
caccagaaccaaccaagaagaattgtgggactagaaggaaaacactaattggtagtgttgtttggttgccttttacaccttttgccactgacaaccgttt |
213 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47003027 |
caccagaaccaaccaagaagaattgcgggactagaaggaaaacactaattggtagtgttgtttggttgccttttacaccttttgccactgacaaccgttt |
47002928 |
T |
|
| Q |
214 |
cacttcaatcagagaagcagctgccattccgattgtcgacaacaaaagtccaatggcaattctttgtaggttggagaaacctgtgatacatagaaaacag |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47002927 |
cacttcaatcagagaagcagctgccattccgattgtcgacaacaaaagtccaatggcaatcctttgtaggttggagaaacctgtgatacatagaaaacag |
47002828 |
T |
|
| Q |
314 |
gcaggtcagttgataattaaattaatagttcatgttatatgcataacagatcgagttgttttagacctggtttt |
387 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47002827 |
gcaggtcagttgataattaaattaatagttcatgttatatgcataacagatcgagttgttttagacctggtttt |
47002754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University