View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16666_low_26 (Length: 206)
Name: NF16666_low_26
Description: NF16666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16666_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 61; Significance: 2e-26; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 127 - 191
Target Start/End: Original strand, 38195761 - 38195825
Alignment:
| Q |
127 |
gaaagaattatacgctcatcttgaaaacaggaagaattttatgcgaaaatgtaaatttggagaat |
191 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38195761 |
gaaagaattatacgctcatcttgaaaacaagaagaattttatgcgaaaatgtaaatttggagaat |
38195825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 38195534 - 38195591
Alignment:
| Q |
1 |
tagttttatatttagtcactataaaagtaaaataagattaaacttagactaaacttaa |
58 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38195534 |
tagttttatatttagtcactataaaagcaaaataagattaaacttagactaaacttaa |
38195591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 67 - 97
Target Start/End: Original strand, 38195583 - 38195613
Alignment:
| Q |
67 |
taaacttaaaagtagtgaacttcatagggaa |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
38195583 |
taaacttaaaagtagtgaacttcatagggaa |
38195613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University