View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16667_high_5 (Length: 250)
Name: NF16667_high_5
Description: NF16667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16667_high_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 9 - 233
Target Start/End: Complemental strand, 37544470 - 37544246
Alignment:
| Q |
9 |
acatcatcacactaatttaaccaattagcaagtgaatgcatgatatgacaggttcctctcccctctacccattatactcaagaatcatgaaaaccactgc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37544470 |
acatcatcacactaatttaaccaattagcaagtgagtgcatgatatgacaggttcctctcccctctacccattatactcaagaatcatgaaaaccactgt |
37544371 |
T |
|
| Q |
109 |
ttgttattcaaaatctctaatttaaaaccgaatcacactcatgcataggaggggatttggatgaagaacccacctcaagtatagatttcataaattgaaa |
208 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37544370 |
ttgttattcaaaatctctaatttaaaaccaaatcacactcatgcataggaggggatttggatgaagaacccacctcaagtatagatttcataaattgaaa |
37544271 |
T |
|
| Q |
209 |
tggtggtgaagatgacggtcaggac |
233 |
Q |
| |
|
||| ||||||||||||||||||||| |
|
|
| T |
37544270 |
tggcggtgaagatgacggtcaggac |
37544246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University