View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16667_low_7 (Length: 239)
Name: NF16667_low_7
Description: NF16667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16667_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 29256067 - 29256287
Alignment:
| Q |
1 |
tatcataactgatggcctaatccattagtttgtttgggcattgacttatccctattttgttttattggcattgttgccattgtaattaactgtgaactct |
100 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29256067 |
tatcataactgatggcttaacccattagtttgtttgggcattgacttatacctattttgttttattggcattgttgccattgtaattaactgtgaactct |
29256166 |
T |
|
| Q |
101 |
cattgcattttgtcatggtatgctttatgctagagagaatgtgctttcagtaatgtacatattctattttggcatgcaacggnnnnnnnntggagcaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
29256167 |
cattgcattttgtcatggtatgctttgtgctagagagaatgtgctttcagtaatgtacatattctattttggcatgcaacgggaaaaaaatggagcaaat |
29256266 |
T |
|
| Q |
201 |
ttgactcggcataacctaacg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
29256267 |
ttgactcggcataacctaacg |
29256287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University