View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16668_high_19 (Length: 411)
Name: NF16668_high_19
Description: NF16668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16668_high_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 54; Significance: 7e-22; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 205 - 285
Target Start/End: Original strand, 36942372 - 36942453
Alignment:
| Q |
205 |
gggctgagcttttttaataaattttgccaactttaga-aagaaaaacttgctgctatttattttttatgtgcttgtgtgtgt |
285 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || | | ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36942372 |
gggctgagctttttaaataaattttgccaatttaaaacaagaaaaacttgctgctatttattttttatgggcttgtgtgtgt |
36942453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 54 - 94
Target Start/End: Original strand, 36942333 - 36942373
Alignment:
| Q |
54 |
ccttaatatcgtcatagtgcatgtttattttggtttaaagg |
94 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
36942333 |
ccttaatatcgtcatagtccatgtttgttttggtttaaagg |
36942373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University