View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16668_high_39 (Length: 272)
Name: NF16668_high_39
Description: NF16668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16668_high_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 42799895 - 42799982
Alignment:
| Q |
1 |
cacattagcttagtgtgaaattgaagcatctaagaaaatcacttaaatagaacaggtatcatatcatttttagatatgaaaacactgt |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42799895 |
cacattagcttagtgtgaaattgaagcatctaagaaaatcacttaaatagaacaggtatcatatcatttttagatatgaaaacactgt |
42799982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 194 - 272
Target Start/End: Original strand, 42799989 - 42800067
Alignment:
| Q |
194 |
aagtacaaaaattgattgtaaattttagattcatatgtcttttgatcttttcctcatttttattctgaaagtgaaataa |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42799989 |
aagtacaaaaattgattgtaaattttagattcatatgtcttttgatcttttcctcatttttattctgaaagtgaaataa |
42800067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University