View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16668_high_51 (Length: 217)
Name: NF16668_high_51
Description: NF16668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16668_high_51 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 39 - 201
Target Start/End: Complemental strand, 36425200 - 36425041
Alignment:
| Q |
39 |
tgtcgtgatgcttccgcgaaaataataattttcgttggaagtagcaatttccaaaatagaattatgaaaataatctctaacctgtcagaccacacttgaa |
138 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36425200 |
tgtcgtgatgcttccgcgaaaataat---tttcgttggaagtagcaatttccaaaatagaattatgaaaataatctctaacctgtcagaccacacttgaa |
36425104 |
T |
 |
| Q |
139 |
gagtatcatcgccttggctctggtaaacaagcaagccaccggcccattcctcactcttgttat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36425103 |
gagtatcatcgccttggctctggtaaacaagcaagccacctgcccattcctcactcttgttat |
36425041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 10 - 41
Target Start/End: Complemental strand, 36425246 - 36425215
Alignment:
| Q |
10 |
ggtggagtacagttaataaaggggtccagtgt |
41 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
36425246 |
ggtggagtacagttaataaaggggtccagtgt |
36425215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University