View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16668_low_30 (Length: 308)
Name: NF16668_low_30
Description: NF16668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16668_low_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 10 - 289
Target Start/End: Original strand, 52796727 - 52797006
Alignment:
| Q |
10 |
tagattatactatcatgcgattaaggttatgaaatatgctgggaaacccaacgttgcggatttcttccccatattgaagtggcttgaccctcaaggtata |
109 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52796727 |
tagattctattatcatgcgattaaggttatgaaatatgctgggaaacccaacgttgcggatttcttccccatattgaagtggcttgaccctcaaggtata |
52796826 |
T |
|
| Q |
110 |
aggagaaacacacagttccatgttgagagagcttttgagatagcaggatggttcatcaaacaaaggatggaaaatgatactgttggaaatggaaacagta |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
52796827 |
aggagaaacacacagttccatgttgagagagcttttgagatagcaggatggttcatcaaacaaaggatggaaaatgatattgttggaaatggaaacagta |
52796926 |
T |
|
| Q |
210 |
aagacttcttggatgtgctcttgcagtttcgtggggatggtgtcagcgggccctacagttttacttcaagaactattaac |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52796927 |
aagacttcttggatgtgctcttgcagtttcgtggggatggtgtcagcgggccctacagttttacttcaagaactattaac |
52797006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University