View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16668_low_37 (Length: 285)
Name: NF16668_low_37
Description: NF16668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16668_low_37 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 118; Significance: 3e-60; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 18 - 153
Target Start/End: Complemental strand, 29002049 - 29001917
Alignment:
| Q |
18 |
tgaagaacaattcaaagtctttaactttatcatcagaatctgtcaaggaataatagtcctccttgctgcattttttctgtgatgggtgagtgatgaattc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29002049 |
tgaagaacaattcaaagtctttaactttatcatcagaatctgtcaaggaata---gtcctccttgctgcattttttctgtgatgggtgagtgatgaattc |
29001953 |
T |
|
| Q |
118 |
gtcacagaacaattcagagtctttgacataaacaac |
153 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29001952 |
gtcacagaacaattcagagtctttgacatcaacaac |
29001917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 207 - 271
Target Start/End: Complemental strand, 29001863 - 29001799
Alignment:
| Q |
207 |
gatgtggttcattggtttggttttcttgctcaattggattggtggtagtttctaaaatggtggtt |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29001863 |
gatgtggttcattggtttggttttcttgctcaattggattggtggtagtttctaaaatggtggtt |
29001799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 207 - 265
Target Start/End: Complemental strand, 28962149 - 28962091
Alignment:
| Q |
207 |
gatgtggttcattggtttggttttcttgctcaattggattggtggtagtttctaaaatg |
265 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
28962149 |
gatgtggttcattggtttggttttctagctcaattgggttggtggtagtttctaaaatg |
28962091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University