View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16668_low_47 (Length: 253)
Name: NF16668_low_47
Description: NF16668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16668_low_47 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 9 - 238
Target Start/End: Complemental strand, 45560527 - 45560298
Alignment:
| Q |
9 |
agcagagaggtgcaacatttatgttttggtgggttgttgcttatcaaagacaacccagaagcacatggacgttattatccctttttacttaccccattga |
108 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45560527 |
agcagaaaggtgcaacatttatgttttggtgggttgttgcttatcaaagacaacccagaagcacatggacgtttttatccctttttacttaccccattga |
45560428 |
T |
|
| Q |
109 |
attgaaatacttatttttggtaaaatatttggtcaattaaaatgtcattctcctactcattttaaatgctagagcttggtaaagttacaatctagctact |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45560427 |
attgaaatacttatttttggtaaaatatttggtcaattaaaatgtcattctcctactcattttaaatgctagagcttggtaaagttacaatctagctact |
45560328 |
T |
|
| Q |
209 |
gattttaacatccaaacttgggttgctatt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
45560327 |
gattttaacatccaaacttgggttgctatt |
45560298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University