View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16668_low_53 (Length: 228)
Name: NF16668_low_53
Description: NF16668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16668_low_53 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 24 - 221
Target Start/End: Complemental strand, 26880754 - 26880557
Alignment:
| Q |
24 |
atgtggcaatggagtgcgatgctttgctaaatttgtttctcagcttgagagtttatatgggaggcataggtatgttcatttccataaactcttaccatct |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26880754 |
atgtggcaatggagtgcgatgctttgctaaatttgtttctcagcttgagagtttataggggaggcataggtatgttcatttccataaactcttaccatct |
26880655 |
T |
|
| Q |
124 |
taatttttatgtcttgttgcttgcggtgttgtgtttttagggcaagttttttccgaagcatttaattttcactgatgaaagttttgtattttgatgat |
221 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26880654 |
taattttcatgtcttgttgcttgcggtgttgtgtttttagggcaagttttttccgaagcatttaattttcactgataaaagttttgtattttgatgat |
26880557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 10 - 104
Target Start/End: Complemental strand, 40251848 - 40251754
Alignment:
| Q |
10 |
ctttgtcctttgatatgtggcaatggagtgcgatgctttgctaaatttgtttctcagcttgagagtttatatgggaggcataggtatgttcattt |
104 |
Q |
| |
|
|||| ||||| ||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| |||| ||||||||| |
|
|
| T |
40251848 |
ctttttccttagatgtgtggcaatggagtgcgatgctttgccaaatttgtttctcagcttgagagtttacatgggaggcacaggtttgttcattt |
40251754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University