View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16671_low_11 (Length: 265)
Name: NF16671_low_11
Description: NF16671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16671_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 20 - 254
Target Start/End: Original strand, 10495183 - 10495413
Alignment:
| Q |
20 |
cagatatccagacgttgcgaatctgctccattggttcagacatggctgctgctgctgcgtttcaacttcnnnnnnnnnnggatagaaaacaatagaatga |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10495183 |
cagatatccagacgttgcgaatctgctccattggttcagacatggttgctgctgctgcgtttcaacttcttttgtt----gatagaaaacaatagaatga |
10495278 |
T |
 |
| Q |
120 |
aatggaattgcgtgctatgtaaaaccctttgggtaaaacccttccttgggggtgcgtaggtttatagtgtgtgaggctgatcttcgtactataatcacac |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
10495279 |
aatggaattgcgtgctatgtaaaaccctttgggtaaaacccttccttgggggtgcgtaggtttacagtgtgtgaggctgatcttcgtactatactcacac |
10495378 |
T |
 |
| Q |
220 |
ctcatcgttcgtttcaattcccgcttcttcttcat |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
10495379 |
ctcatcgttcgtttcaattcccgcttcttcttcat |
10495413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 20 - 82
Target Start/End: Original strand, 10509388 - 10509450
Alignment:
| Q |
20 |
cagatatccagacgttgcgaatctgctccattggttcagacatggctgctgctgctgcgtttc |
82 |
Q |
| |
|
|||| ||||||| ||| |||||||||| |||||| |||||||||| ||||||||||||||||| |
|
|
| T |
10509388 |
cagagatccagatgtttcgaatctgcttcattggctcagacatggttgctgctgctgcgtttc |
10509450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 100 - 154
Target Start/End: Original strand, 10509475 - 10509529
Alignment:
| Q |
100 |
gatagaaaacaatagaa-tgaaatggaattgcgtgctatgtaaaaccctttgggta |
154 |
Q |
| |
|
||||||||||||||||| |||||||||| | |||||||||||||||||||||||| |
|
|
| T |
10509475 |
gatagaaaacaatagaaatgaaatggaaatt-gtgctatgtaaaaccctttgggta |
10509529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University