View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16672_low_2 (Length: 275)
Name: NF16672_low_2
Description: NF16672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16672_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 1 - 258
Target Start/End: Complemental strand, 35184658 - 35184402
Alignment:
| Q |
1 |
gactattccaacttattgtctatcgttaagctgattttcgaagagaaacatttgcaccacatgtatgtttaaaagtgaaattgaactaattagtcaaata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35184658 |
gactattccaacttattgtctatcgttaagccgattttcgaagagaaacatttgcaccacatgtatgattaaaagtgaaattgaactaattagtcaaata |
35184559 |
T |
|
| Q |
101 |
cttcaacacgaccaagacgctcaattatcccacacnnnnnnnnaaaaggcaaccactacattaattttcttgccaaaattaatgcccaagacatctaaat |
200 |
Q |
| |
|
||| ||||||||| ||||| ||||||||||||||| ||||| ||||||||||| ||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
35184558 |
cttaaacacgaccgagacgttcaattatcccacac-tttttataaaagacaaccactacactaattttcttgtcaaaattaatgcccaagacatccaaat |
35184460 |
T |
|
| Q |
201 |
aatttgatgacccccaatttatctcttgcttagacggaccatctctttttaccaaaca |
258 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
35184459 |
aatttgatggcccccaatttatctctcgcttagacggaccatttctttttaccaaaca |
35184402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University