View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16673_high_3 (Length: 345)
Name: NF16673_high_3
Description: NF16673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16673_high_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 8e-86; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 8e-86
Query Start/End: Original strand, 13 - 245
Target Start/End: Original strand, 33942226 - 33942445
Alignment:
| Q |
13 |
tcatcaactctttgcaatgaaaattcataatcaaattagtcagcttgaaattataagctaaataaatatcttagttgaaaaggtccaacaaaatcaaatt |
112 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33942226 |
tcatcaactctttgaaatgaaaattcataattaaattagtcagcttgaaattataagctaaataaatatcttagttgaaaaggtccaacaaaatcaaatt |
33942325 |
T |
 |
| Q |
113 |
actgaaacaacaatagtagattgattatagaaaaatactacggatatgcctgcctcttttgctttcgagcttcttcatccccctcatgcaatttttgtag |
212 |
Q |
| |
|
||| |||||||||||||||||||||| || |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33942326 |
actcaaacaacaatagtagattgattgta-------------tatatgcttgcctcttttgctttcgagcttcttcatccccctcatgcaatttttgtag |
33942412 |
T |
 |
| Q |
213 |
tctctcttttactcccaactgaagacaatactt |
245 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
33942413 |
tctctcttttacccccaactgaagacaatactt |
33942445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 239 - 307
Target Start/End: Original strand, 33942465 - 33942532
Alignment:
| Q |
239 |
aatactttctcttcatactccatctgcaaagtctatcattaaaagattgattatggcaagatatgtaat |
307 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33942465 |
aatactttctcttc-tactccatctgcaaagtctatcattaaaagattgattatggcaagatatgtaat |
33942532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 298 - 341
Target Start/End: Original strand, 33942533 - 33942576
Alignment:
| Q |
298 |
gatatgtaatcctcaccatatgactaagccgcttcatctctctc |
341 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| | |||||||| |
|
|
| T |
33942533 |
gatatgtaatcctcgccatatgactaagccgctccttctctctc |
33942576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University